SciELO - Scientific Electronic Library Online

 
vol.71 issue4Is the histoplasmosis an occupational hazard between the investigators who perform field workEvaluation of the toxicological effect grade of dichlorvos after its exposure in environment without ventilation author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Revista do Instituto Adolfo Lutz (Impresso)

Print version ISSN 0073-9855

Rev. Inst. Adolfo Lutz (Impr.) vol.71 no.4 São Paulo  2012

 

BRIEF COMMUNICATION/COMUNICAÇÃO BREVE

Evaluation of polymerase chain reaction (PCR) for identifying Mycobacterium bovis isolates from the modified Middlebrook 7H11 agar thin layer technique

 

Avaliação da técnica de reação de polimerase em cadeia (PCR) para identificação de Mycobacterium bovis em microcolônias isoladas em camada delgada de ágar Middlebrook 7H11 modificado

 

 

Tatiana Reis do RosárioI*; Cristina Corsi DibII; Eliana RoxoII; Sônia Regina PinheiroI; Silvio Arruda VasconcellosI;Nilson Roberti BenitesI

ILaboratório de Zoonoses Bacterianas, Departamento de Medicina Veterinária Preventiva e Saúde Animal, Faculdade de Medicina Veterinária e Zootecnia da USP. São Paulo, SP
IIInstituto Biológico, Agência Paulista de Tecnologia dos Agronegócios, São Paulo, SP

 

 

RIALA6/1533


ABSTRACT

The associated use of the modified Middlebrook 7H11 agar thin layer technique and the Polymerase Chain Reaction (PCR) assay enabled to perform the early identification of microcolonies of Mycobacterium bovis from 12th to 25th day of culture. In order to reduce the time for performing the Mycobacterium bovis identification, the combined use of these two techniques was evaluated by analyzing the microcolonies of mycobacteria at the 8th day after culturing. Until the last day of analysis, all of the PCR-positive samples already showed the microcolonies. Therefore, the early diagnosis of bovine tuberculosis is feasible, without an apparent macroscopic colonies growth.

Keywords. tuberculosis, Mycobacterium bovis, diagnostic techniques and procedures, Polymerase Chain Reaction, early diagnosis.


RESUMO

A associação da técnica de cultivo em camada delgada no meio de ágar Middlebrook 7H11 modificado com a Reação de Polimerase em Cadeia (PCR) possibilitou a identificação precoce de Mycobacterium bovis em colônias macroscópicas entre o 12º e o 25º dia de crescimento. Com o objetivo de diminuir o tempo necessário para efetuar a identificação de Mycobacterium bovis, avaliou-se o uso combinado dessas duas técnicas, em microcolônias de micobactérias, no oitavo dia pós-semeadura. Até o último dia de observação, todas as amostras com positividade no ensaio da PCR já apresentavam crescimento microscópico, possibilitando-se a realização de diagnóstico precoce da tuberculose bovina mesmo sem aparente crescimento macroscópico das colônias.

Palavras-chave. tuberculose, Mycobacterium bovis, técnicas e procedimentos diagnósticos, PCR, diagnóstico precoce.


 

INTRODUCTION

Mycobacterium bovis is the causative agent of bovine tuberculosis, a disease responsible for losses to agriculture worldwide that amount to 3 billion dollars, and that has serious repercussions in public and animal health1.

Early detection of the causative agent in food-producing animals is important to cull infected animals in a herd, and to adopt adequate measures to locate outbreaks and, consequently, reduce the risk of products of animal origin serving as sources of infection to humans2. Infection is confirmed by the isolation and identification of M. bovis3,4. Isolation of M. bovis may be carried out by Petroff's traditional method and culture with egg-based media, such as Stonebrink medium, or agar-based media, such as modified Middlebrook 7H11 medium, both of which have sodium pyruvate as the carbon source. However, identification by biochemical or molecular methods3 is done only after growth is visible. This occurs after 3 to 5 weeks of incubation, and may take more than 12 weeks in Stonebrink medium, or between 12 to 26 days in modified Middlebrook 7H11 medium3,5.

In order to decrease the time to M. bovis detection, several molecular methods, such as Polymerase Chain Reaction (PCR), have been employed in the diagnosis of bovine tuberculosis using samples of suspect tuberculosis lesions. This technique, however, has low sensitivity when carried out straight in tissue samples, due to the difficulty in extracting DNA from the samples, the variable amount of bacilli found in the lesions, the presence of PCR inhibitors, contamination with DNA from the host and other microorganism species3,6-8, making it necessary to use PCR in colonies obtained by isolation, which is the gold standard for diagnosis.

In an attempt to reduce time to diagnosis, in a previous study modified Middlebrook 7H11 medium thin layer technique was used for the isolation of M. bovis in suspect bovine tuberculosis lesions collected from cattle and buffaloes in commercial slaughterhouses, followed by PCR for the identification of the colonies. Thus, the number of days to diagnosis was reduced to 12-25, compared with 42 to 91 days required for visible colonies in Stonebrink medium. As diagnosis confirmation by PCR was carried out after macroscopic growth of the colonies, the present study evaluated the association of modified Middlebrook 7H11 medium thin layer technique and PCR before macroscopic colonies were visible. Plates were observed for no more than 12 days to achieve the earliest possible diagnosis in samples with lesions suggestive of tuberculosis.

 

MATERIAL AND METHODS

A total of 10 samples of bovine tuberculosis suspect lesions. Eight of them were considered positive in a previous study, after processing and culture in Stonebrink medium and modified Middlebrook 7H11 medium thin layer culture9, followed by confirmation by PCR (Table 1).

 

The ten samples were decontaminated by Petroff's traditional method10 and cultured in plates with modified Middlebrook 7H11 medium, in duplicate, in a total of 20 plates. The attempt was to have an earlier perception of the colonies and to identify them by PCR, no matter the macroscopic growth of the colonies.

Readings in optical microscope were carried out on days 5, 8 and 12 after culture. On the 13th day, plates were removed from the incubator and opened in a level 3 microbiological safety cabinet. All the content on the surface of the medium was scraped with a disposable loop, and resuspended in 1.5-mL tubes with sterile ultrapure water. Inactivation was carried out by boiling at 100 ºC for five minutes, followed by freezing at -20 ºC for at least one hour before use11.

Thawed samples were submitted to PCR using primers JB-21 (5' TCGTCCGCTGATGCAAGTGC 3') and JB-22 (5' CGTCCGCTGACCTCAAGAAG 3'), described by Rodriguez et al.12 for the identification of Mycobacterium bovis, generating a 500-bp final product.

Amplification with primers JB-21 and JB-22 was carried out in a thermocycler, with initial treatment at 94 ºC for two minutes, followed by 35 cycles at three different temperatures: denaturation at 94 ºC for 30 seconds, hybridization at 64 ºC for 30 seconds, and extension and annealing at 72 ºC for 60 seconds. After the last cycle, samples were kept at 72 ºC for five minutes, and the amplified product was analyzed in a horizontal electrophoresis system. Agarose gels 1.5% containing 0.01% ethidium bromide were analyzed under ultraviolet light and photographed.

 

RESULTS AND DISCUSSION

From the ten samples in modified Middlebrook 7H11 medium thin layer culture, nine were considered positive and submitted to confirmation by PCR. As no macroscopic growth was observed, this stage was interrupted on day 12 after culture. The only sample considered negative in the thin layer plates was also negative in PCR. However, two plates considered positive were not confirmed in PCR

 

Although the nine samples positive in this second stage were also positive in the first one, negative PCR results for samples 37 and 49 may be partially related to the amount of colonies collected from the plates to be used in PCR. Although PCR may detect very small amounts of live and dead bacilli in the sample13, as there was no macroscopic growth in the marked areas at the moment of colony collection, only the location marked during reading in the microscope was considered. Thus, it is possible that, in this case, culture medium collection with the loop was not adequate.

In spite of the fact that the colonies were visually similar to those observed by Marcondes et al.5 and Dib et al.14, at initial stages, they may also be similar to those of other bacteria, leading to negative results in PCR. Bacteria of the genus Nocardia may have filamentous and bacillary forms15, and may sometimes be mistakenly considered mycobacteria in the initial stages of growth, reinforcing the importance of the association of methods with PCR in the identification of M. bovis.

Results for the period of observation for presence or absence of mycobacteria growth in microscopic colonies in modified Middlebrook 7H11 thin layer culture showed seven of the plates with positive results in isolation and PCR. On the 8th day after culture, all samples that were confirmed to be positive in PCR had already been considered positive in culture, but observation continued until the 12th day because there were expectations for visible macroscopic growth that would confirm microscopic findings.

It is believed that this stage led to greater accuracy in the observation of the colonies due to the visual training carried out in the first stage of the experiment, which enabled the identification of the initial growth stages and the differentiation of cell debris5. Thus, at 5 days after culture, it was possible to safely state that the three plates considered positive in the second stage showed initial colony growth.

It was observed that, when reduction of time to reading is prioritized, the absence of macroscopic growth may lead to errors in the technique or insufficient amounts of sample for PCR, increasing the probability of having false positive results. However, the association of PCR for earlier confirmation of the results (12 days instead of the 36 days observed in previous studies) seems to be advantageous, as microscopic findings may be confirmed without the apparent need for observing macroscopic colony growth.

 

REFERENCES

1. Bermudez HR, Renteria ET, Medina BG, Hori-Oshima S, De La Mora VAV, Lopez VG, et al. Correlation between histopathological, bacteriological and PCR diagnosis of bovine tuberculosis. J Anim Vet Advances. 2010;9:2082-8.         [ Links ]

2. Hosek J, Svastova P, Moravkova M, Pavlik I, Bartos M. Methods of mycobacterial DNA isolation from different biological material: a review. Vet Med-Czech. 2006;51:180-92.         [ Links ]

3. OIE. Bovine tuberculosis. In: OIE. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. 2009. Chapter 2.4.7. 16p. Available from: http://www.oie.int/en/international-standard-settin/terrestrial-manual/access-online         [ Links ]

4. Stewart LD, McNair J, McCallan L, Thompson S, Kulakov LA, Grant IR. Production and evaluation of antibodies and phage display-derived peptide ligands for immunomagnetic separation of Mycobacterium bovis. J Clin Microbiol. 2012;50:1598-605.         [ Links ]

5. Marcondes AG, Shikama MLM, Vasconcellos SA, Benites NR, Morais ZM, Roxo E, et al. Comparação entre a técnica de cultivo em camada delgada de ágar Middlebrook 7 H11 e meio de Stonebrink para isolamento de Mycobacterium bovis em amostras de campo. Braz J Vet Res Ani Sci. 2006;43:362-9.         [ Links ]

6. Stewart LD, McNair J, McCallan L, Gordon A, Grant IR. Improved detection of Mycobacterium bovis infection in bovine lymph node tissue using immunomagnetic separation (IMS) - based methods. Plos One. 2013;8:e58374.         [ Links ]

7. Collins DM, Radford AJ, de Lisle GW, Billman-Jacobe H. Diagnosis and epidemiology of bovine tuberculosis using molecular biological approaches. Vet Microbiol. 1994;40:83-94.         [ Links ]

8. Roxo E, Ikuno AA, Ferreira VCA, Harakava R, Ruggiero APM, Vialta A. Avaliação de diferentes protocolos de extração de DNA de Mycobacterium bovis a partir de leite. Arq Inst Biol. 2002;69 Supl:46.         [ Links ]

9. Universidad de las Naciones Unidas. Nuevas tecnologias para el diagnóstico y pruebas de susceptibilidad a drogas de M. tuberculosis para países en vias de desarollo. In: Programa de Biotecnologia para Latinoamérica y el Caribe - BIOLAC. Red Latinoamericana y del Caribe de tuberculosis - RELACTB. La Paz (Bolivia); 1998:18-21.         [ Links ]

10. De Kantor IN. Organización Panamericana de la Salud. Centro Panamericano de Zoonosis. Bacteriología de la tuberculosis humana y animal. Série de Monografias Científicas y Técnicas. 1998;11(1):63.         [ Links ]

11. Bemer-Melchior P, Drugeon HB. Inactivation of Mycobacterium tuberculosis for DNA Typing Analysis. J Clin Microbiol. 1999;37:2350-1.         [ Links ]

12. Rodriguez JG, Mejia GI, del Portillo P, Patarroyo ME, Murillo LA. Species-specific identification of Mycobacterium bovis by PCR. Microbiology. 1995;141:2131-8.         [ Links ]

13. Beige J, Lokies J, Schaberg T, Finckh U, Fischer M, Mauch H, et al. Clinical evaluation of a Mycobacterium tuberculosis PCR assay. J Clin Microbiol. 1995;33:90-5.         [ Links ]

14. Dib CC, Morais ZM, Souza GO, Amaku M, Benites NR, Pinheiro SR. Utilização de uma técnica rápida para o diagnóstico de Mycobacterium bovis em amostras de leite experimentalmente inoculadas. Arq Inst Biol. 2006;73:149-55.         [ Links ]

15. Trabulsi LR, Alterthum F. Microbiologia. 5.ed. São Paulo: Atheneu; 2008.         [ Links ]

 

*Endereço para correspondência: Laboratório de Zoonoses Bacterianas, Departamento de Medicina Veterinária Preventiva e Saúde Animal, Faculdade de Medicina Veterinária e Zootecnia da USP, Av. Prof. Dr. Orlando Marques de Paiva, 87, CEP: 05508-270, São Paulo, SP, Brasil. E-mail: tatianareis@yahoo.com.br

Recebido: 28.06.2012
Aceito para publicação: 22.11.2012